Sentence examples for site specific point from inspiring English sources

Exact(1)

The mutant constructs pF/H426-UBP2-C745S and pF/H426-RUP1-Y135F, bearing site specific point mutations were constructed using the QuikChange II Site-Directed Mutagenesis kit (Stratagene).

Similar(58)

Site-specific nucleases create DNA double stranded breaks which, during repair, can be used to introduce site-specific point mutations, insertions and deletions into the plant genome.

They share two important features that suggest sequence-specific aggregation: oligomeric intermediates as precursors to the aggregated sate and sensitivity to site-specific point mutations.

Nested deletions and site-specific point mutations of the CRE located at nucleotide −224 resulted in a significant loss of induction by cAMP, demonstrating that CREB binding is necessary for the stimulation of the gene [13].

We generated a site-specific point mutant in which the invariant core tyrosine residue 135 was substituted with a phenylalanine (Y135F), and expressed this from an episomal plasmid in a strain lacking endogenous RUP1.

A CXCR7-DRYLAIV mutant was generated by introducing site-specific point mutations at amino acids Ser(145) and Thr(147) of human CXCR7 by PCR (AccuPrime™ Pfx SuperMix, Invitrogen) with the following primers: 5' CCGCTACCTCGCCATCGTCTACTTCACC, 5' GGTGAAGTAGACGATGGCGAGGTAGCGG.

The somatic site-specific point mutations typical of MNGIE render this disease unique.

Site-specific point mutations were prepared with the QuikChange site-directed mutagenesis kit (Stratagene) and expressed and purified following the same protocol as described for wild-type crammer.

Whereas in our study, the use of cells expressing receptors containing site-specific point mutations impeded the binding of endogenous skelemin but not the interactions of other cellular proteins with the integrin tails.

However, given that sentinel surveillance conducted in ABCs sites has been shown to detect pneumococcal resistance trends over time (19 ) and that in our study antibiograms provided site-specific point estimates of antibiotic resistance similar to those measured by active sruveillance, antibiograms may be able to follow trends in pneumococcal antimicrobial resistance at the local level.

To better understand the functional role of the FT-1 and FT-6 regions in the transcriptional activity of the CNS87, we decided to mutagenize them by generating site-specific point mutations in both TTF-1 binding sites, separately or in combination.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: