We based the model on 44 known predation sites obtained through 102 interviews with rural pastoralists and mapped risk at a 500 m spatial scale.
A mutated version (T789 m) of this construct carrying a 7-bp substitution in the miR-181 binding site was obtained through site-directed mutagenesis.
A mutant, here termed arp-1, with an R354W substitution in a conserved site was obtained through the TILLING procedure (Fig. 1)[8], and strains containing the mutation were identified by treating a PCR product, synthesized with forward ("Arp7", 5'andGTTGAAGTTTGAGAGCTTC3') and reverse ("Arp10", 5'TAAGTGTAACCGACAACACCAG3') primers, with NlaIII restriction enzyme.
It is likely that many of the most conserved sites ('MCS', obtained through phastCons) are shared among the sets of sites identified using different alignments with a varying number of investigated species.
Three significant groups, upper catchments (UC), middle catchments (MC) and lower catchments (LC) of sampling sites were obtained through CA on the basis of similarity between them.
The above result allows us to define a stochastic evolution process with independent sites that reproduces the site-specific distributions obtained through the SCN model where sites are interacting.
A 42 site sample was obtained through simple randomization of the whole universe; 37 correspond to canal sites and five, to wastewater treatment plant effluents to the canal system.
These direct measurements were compared with modeled estimates of mercury dry-deposition to the site that were obtained through the use of an inferential or "bigleaf" model that was modified for use with speciated mercury.
The seismic risk can be described as the probability of loss at a given site and is obtained through the convolution of three parameters: exposure, vulnerability and seismic hazard.
Distances and standard error values are given as percentages per site; standard errors obtained through 1000 bootstrap replicates in parentheses.
