Your English writing platform
Discover LudwigSuggestions(1)
Exact(3)
To facilitate the separation of the two complementary strands, we introduced a recognition site for restriction enzyme Hpy99I into the probe positioned between the tandem repeats and downstream to the recognition site for PspGI.
The consensus sequence of OwlAlp1 carried a recognition site for restriction enzyme NdeI (CATATG), whereas that of OwlAlp2 did not.
The mutation is in the following sequence: GCAAGTTTACCAATCTTCCC G CTGGGTTCCAGTTATCAAGG. As this mutation creates an additional site for restriction endonuclease digestion using TspRI, the mutation was rechecked by TspRI digestion of the PCR product.
Similar(57)
The mutation in patient 2 created a restriction site for the restriction enzyme StyI and controls were screened for this site using a restriction fragment length polymorphism.
The italic bases are recognition sites for restriction endonuclease enzymes.
Additional input parameters included potential cleavage sites for restriction endonucleases or proteases to avoid such that the selected linkers would be resistant against the restriction enzymes and the specified protease during the DNA cloning and protein purification process, respectively.
There sulting vectors have 2A sequences flanked by several unique recognition sites for restriction endonucleases (Fig. 1C).
The following primers introduced XhoI and BamHI site, respectively, in the PCR product: 5'-GGAGATCTCGAGATGGATCAGAACAAC-3'and 5'-GCAGCCGGATCCCGTCGTCTTCCT-3' Underlined sequences in the primers mentioned above represent the sites for restriction endonucleases.
Sites for restriction endonucleases are indicated in bold or italic.
Truncated sequences may lose recognition sites for restriction enzymes, too.
Nucleotides in small letters encode sites for restriction endonucleases.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com