Your English writing platform
Discover LudwigExact(11)
This assay subjected each sample to both an empty site assay (stage 1) and an internal primer test (stage 2).
For pol II binding site assay, Fpol: tcgtccctacaggagcattc, Rpol: cagcttcagcttccacttcc, and the amplified fragment was 160 bp.
Third, methodological changes in A1C and FPG measurement occurred after the 2003 2004 NHANES cycle, including a new laboratory site, assay method enhancements, and instrument upgrades (23– 23).
Radioligand binding assays including gabapentin-binding site assay in the rat brain cortex (catalog no. 230000) were conducted at Eurofins Panlabs, Inc. (Taipei, Taiwan).
PCR Validation of Novel Insertions Germline retrotransposon insertions detected by RC-seq were assayed by PCR using a standard empty site / filled site assay.
The assay for serum insulin was performed at the Diabetes Endocrinology Research Center Immunoassay Core Laboratory University off Washington), and quantified by a two site assay using a Tosoh 2000 auto-analyzer (Tosoh Biosciences Inc., South San Francisco, CA).
Similar(49)
We also show that BC hybrids can function efficiently in HeLa cells, in both extra-chromosomal and pseudo site assays.
> -wrap-foot> aAssociation between GDM and methylation of CpG site assayed by pyrosequencing in closest proximity to the site chosen for validation based on methylation array data.
It is also found within a DNaseI hypersensitive cluster observed in several cell types and an RNA polymerase II transcription factor binding site assayed by ChIP-seq [ 26] in multiple cell lines suggesting that it affects transcription.
The colorimetric sensor shows a great potential application for the rapid and on-site assay of BPO in flour samples.
The fluoroimmunoassay was a solid phase, two-site assay based on the direct sandwich technique.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com