Although dihaploid lines may simplify sequence assembly in switchgrass, they are not preferred for whole genome sequencing because of their elevated infertility and instability [ 126, 127].
In order to deal with the large volume of data generated from the next-gen sequencing run, we developed a bioinformatics pipeline to computationally clean, trim, group, analyze, and simplify sequence data dubbed BarcodeCruncher (available at: http://crandalllab.byu.edu/ComputerSoftware.aspx).aspx
The use of ID-tag markers incorporated in the probes simplified sequence read-out in the current PathogenMip Assay, but a more forward looking approach involves refinement of the in-house barcode-chip hybridization piloted here.
Furthermore, MY09/11 primers amplify a region containing highly conserved amino acids, which simplifies sequence alignment in HPV classification (Chan et al, 1995).
The GP5+/6+ primers [ 9, 10] were modified by the addition of SeqA2 (GAATTCTCTAGATGATCAGCGGC) or Seq B2 (CGAACTTTATTCGGTCGAAAAGG) tags to their 5′ ends to simplify later sequencing.
Two next-generation sequencing (NGS) systems deliver a comprehensive solution that simplifies targeted sequencing.
To simplify the sequencing data, all identical sequence reads in the small RNA library were grouped and converted into sequence tags.
To simplify the sequencing data, all identical sequence reads in each small RNA library were grouped and converted into sequence tags–unique sequences with associated counts of the individual sequence reads.
To simplify the sequencing data, the identical sequence reads among the 6 small RNA libraries were grouped and converted into unique sequences.
In order to simplify the sequencing process and to reduce the costs associated with individual labelling of DNA samples, we have developed a mutation detection approach based on targeted NGS in combination with high resolution melting (HRM) analysis.
Companies like Helicos Biosciences and Illumina are among the companies vying to develop new technologies to accelerate and simplify the sequencing of single DNA strands.
