Sentence examples for significantly react with from inspiring English sources
Li[NixLi(1/3−2x/3 Mn(2/3−x/3 ]O2 samples charged to 4.8 V versus Li, across the oxygen release plateau, start to significantly react with EC/DEC at about 130 °C.
We identified two peptides (P4 and P13) in the highly conserved region of the DBL5ε domain that significantly reacted with plasma pool from pregnant women of different endemic areas.
We tested the specificity of the anti-Eomesa antibody using in vitro translated Eomesa, Ntla and Tbx16 [ 73] and found that the antibody specifically recognizes Eomesa and does not significantly cross react with Tbx16 or Ntla.
Primers specifically recognized cognate human sequences and did not significantly cross-react with any mouse sequences as determined both in total mouse brain tissues and mouse brain sections obtained by LCM.
The egr-1 RNAi clone used (forward primer - TCTCATTGAAATCCTTGCCC; reverse primer - CTGATGACGTGGCAGAGAAA) was determined to be unlikely to significantly cross-react with egl-27 by comparing the targeting region and the region upstream of the targeting region with the egl-27 genomic sequence using the BLAT alignment tool (Kent, 2002).
Thus, in an attempt to compensate for the resulting decrease in sensory stimuli, rats react with significantly larger than normal, and therefore nonphysiological, vibrissal excursions of the order of 90 degrees [ 40– 40].
The mAb SM5-1 does not recognize a metastases-associated antigen as originally thought but react with a significantly higher percentage of melanoma specimens than any other melanoma associated antibody.
It is a very reactive ion and is the only chemical that will react with sand and clay significantly" (Smith and Hendrickson 1965).
They react with lipid hydroperoxyl radicals producing lipid hydroperoxides and more stable, low energy, antioxidant radicals (Aglyph6) 23, 23, which are significantly much less reactive in propagation reactions 19.
Some students react with outrage.
Officials react with fury to foreign criticism.
