Sentence examples for side assisted from inspiring English sources

Only two executives from Piramal's side assisted Abbott's team in conducting their due diligence over a couple of weeks.

The execution can be either made at the UE side assisted by information provided by the network (UE controlled ANS) or can be controlled directly by the network (network-controlled ANS).

In 1994, he fought with General Dostum against the Taliban until he defected to the Taliban's side and assisted in their victory over Dostum in 1997-98.

HZ designed and directed the projects on the China side and assisted in the collection of samples.

Andy French, general secretary of Ice Hockey UK, said of Thompson: "His commitment and dedication to GB has been top class and he has helped not only the senior side, but assisted and advised the junior programme".

However, after consulting with former Confederate president Jefferson Davis at Davis' home in Mississippi, Hines did not name anybody on the Northern side who assisted in the conspiracy.

In 1994 the SPLA commander from the area, Kerubino Kwanyin Bol, changed sides and, assisted by the government, began to kill and loot his own people.

With no teammate inexplicably at his side to assist him, Millar had trouble slipping the bicycle chain back on its ring so that he could pedal.

In the proposed sender-assisted approach, HAS leverages information on the encoded video available at the server side to assist the client in originating the data requests.

Several strategies can be induced from family side to assist adolescents.

The forward hoxF (5′acgactcaagtccacatagg3′) and the reverse hoxF (5′caccagggtggaagctaaac3′) primers were used to amplify a 3 kb region, which included the hoxF gene flanked by 1 kb either side, to assist with homologous recombination.