Only two executives from Piramal's side assisted Abbott's team in conducting their due diligence over a couple of weeks.
The execution can be either made at the UE side assisted by information provided by the network (UE controlled ANS) or can be controlled directly by the network (network-controlled ANS).
With no teammate inexplicably at his side to assist him, Millar had trouble slipping the bicycle chain back on its ring so that he could pedal.
In the proposed sender-assisted approach, HAS leverages information on the encoded video available at the server side to assist the client in originating the data requests.
Several strategies can be induced from family side to assist adolescents.
The forward hoxF (5′acgactcaagtccacatagg3′) and the reverse hoxF (5′caccagggtggaagctaaac3′) primers were used to amplify a 3 kb region, which included the hoxF gene flanked by 1 kb either side, to assist with homologous recombination.
As the CAHAI has to be performed while sitting, except for task 12 and 13, the therapist was sitting next to the patient's affected side to assist if necessary.
To help with protection, the Eagles kept chip blockers in on both sides to assist their overmatched offensive tackles.
These systems are also called side-view assist, blind spot monitor, and lane change/merge assist.
Comparison of contralateral sides may assist in diagnosis, as can the use of color and spectral Doppler.
In the GPM Ward, a pain assessment scale was posted at the patient's bed-side to assist the patient and medical staff in dynamically assessing pain.
