Although shuttles, tables, and beds are artifacts, and hence perhaps relevantly different from natural kinds, such as human beings and water, there seems no reason to think that humans differ from bees in regard to whether they have corresponding forms.
For complementation and overexpression studies, the PVL locus was amplified by PCR using primer pair CTGACCGCGGTATGACGGCGCATATT-GTATCAATG, and GCCAGGATCCCACGTCAATTAAGACGTGGTTACCC and cloned into shuttle vectors (Table S1).
Young men in showy retro sports jerseys laughed loudly, and women in dressy jewel-toned outfits shuttled from table to table, bringing old friends together and doing a bit of matchmaking.
Similarly, only 6 of the 20 genes involved in lipid metabolism in other microsporidia were found in E. bieneusi, and only 1 of 2 genes for the glycerol-3-phosphate shuttle system was found (table 1, supplementary table S1, Supplementary Material online).
After each minute, the speed increased by 0.17 m/s, indicated by a treble bleep resulting in an increase in the number of shuttles per minute (table 1).
biflexa shuttle vector depicted in Table 1, yielding the plasmids pSLe94/PlipL41/gfp, pSLe94/PligA/gfp and pSLe94/Psph2/gfp (Table 1).
For the occasion, Ms. Carroll has designed a chair inspired by space shuttle furniture and a table inspired by the roof structure of the Astrodome.
She shuttled him to a table in the back, where it was cool and quiet, and brought him a big Thai beer.
Dodging the three cooks he shares the kitchen with, he works quickly and efficiently, shuttling between the preparation table and the walk-in refrigerator so that the meat is always cold.
In the next phase, dynamic scan using two alternating table positions ("shuttle-mode") was performed in the maximal coverage (73 mm) of the left ventricle myocardium during stress activity.
