Sentence examples for shows identity from inspiring English sources

It shows identity with the human SIR-T8 sequence.

The Early gene AS 1972 shows identity with the Drosophila black pearl CG5268 gene product.

On the other hand, sequence GBAK01000358 shows identity to angiotensin-converting enzyme, a carboxypeptidase responsible for converting angiotensin I to angiotensin II, which constricts the blood vessels [ 113].

The tandem arrays of the head to head junction are flanked one-sided by the conserved sequence motif GTCGTCCGACCAAAGATTATGGTCGGACGAGTCCGACACAATACGTTCTCT, which is 50 bp in size and shows identity of 86% to 100%.

The upper line shows identities at the nucleotide level; The lower line shows identities at the amino acid level.

Instead of showing identity between things which are different (Whitman's democratic vista), everybody is shown to look the same".

Before killing them, they asked their victims to give their names or show identity cards, Amnesty said.

But it was the show itself that needed an intervention, shifting from awards to musical numbers better suited to the Tonys and the Grammys: Awards Show Identity Disorder.

Purified trypsin showed identity with the amino-terminal sequence of AAEL005607, AAEL005609 and AAEL005614.

The amino acids showing identity are shaded dark blue, whereas similar amino acids are shaded grey.

People lining up for food had to show identity papers to get the free packages from party volunteers.