Sentence examples for shows identity from inspiring English sources

Exact(4)

It shows identity with the human SIR-T8 sequence.

The Early gene AS 1972 shows identity with the Drosophila black pearl CG5268 gene product.

On the other hand, sequence GBAK01000358 shows identity to angiotensin-converting enzyme, a carboxypeptidase responsible for converting angiotensin I to angiotensin II, which constricts the blood vessels [ 113].

The tandem arrays of the head to head junction are flanked one-sided by the conserved sequence motif GTCGTCCGACCAAAGATTATGGTCGGACGAGTCCGACACAATACGTTCTCT, which is 50 bp in size and shows identity of 86% to 100%.

Similar(56)

The upper line shows identities at the nucleotide level; The lower line shows identities at the amino acid level.

Instead of showing identity between things which are different (Whitman's democratic vista), everybody is shown to look the same".

Before killing them, they asked their victims to give their names or show identity cards, Amnesty said.

But it was the show itself that needed an intervention, shifting from awards to musical numbers better suited to the Tonys and the Grammys: Awards Show Identity Disorder.

Purified trypsin showed identity with the amino-terminal sequence of AAEL005607, AAEL005609 and AAEL005614.

The amino acids showing identity are shaded dark blue, whereas similar amino acids are shaded grey.

People lining up for food had to show identity papers to get the free packages from party volunteers.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: