Sentence examples for shortening strain from inspiring English sources

Exact(1)

In comparison with other parts of Himalaya, crustal shortening in the Easternmost Arunachal is maximum with a shortening strain of 83.28% which may be related with the bending around the Eastern Himalayan Syntaxis.

Similar(59)

During accretion of OPS, megathrust slip is accommodated by imbricate faults and penetrative strain, shortening the unit and leading to tectonic repetition of the OPS sequence, whereas OPS accreted at different times are separated by non-accretionary megathrust horizons.

The postbuckling performance of composite laminated plates for a given compression loading is assessed by studying both the maximum transverse displacement and the end-shortening strain.

Universal vaccines are used as an alternative approach for improving immunogenicity and cross-protection against emerging strains, shortening production time, and reducing side effects [ 24– 26].

As a result, under high strain-rate compressive loading, the strain level at the damage initiation was shortened with increasing strain-rate.

Distal to this in bin, the ATACCCGTACCCGTACCCAT sequence in the Russian 2b strain was shortened to ATACCCGTACCCAT in the Celera strain but absent altogether in the Oregon R strain.

Furthermore, the gE-negative BoHV-1 vaccine shortened the challenge strain shedding.

Using the merged FUSI USP process, the FUSI gate can be processed with the source/drain region silicide in one step, and the poly gate can be thinned to less than 300 Å, thus shortening the distance between the strain contact etch stop layer and the channel to generate higher stress.

Dr. O'Neill, who received $7 million, hopes to find a life-shortening wolbachia strain in fruit flies or to create one by gene modification, and use it to infect mosquitoes, which now harbor benign strains.

This study focused on load-carrying capacity, column shortening, longitudinal strains in strips and stirrups, ductility, and stiffness factors.

The fall of 2016 was the latest freeze-up ever for these bears, shortening their seal-hunting season and straining the limits of their fat reserves.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: