During accretion of OPS, megathrust slip is accommodated by imbricate faults and penetrative strain, shortening the unit and leading to tectonic repetition of the OPS sequence, whereas OPS accreted at different times are separated by non-accretionary megathrust horizons.
The postbuckling performance of composite laminated plates for a given compression loading is assessed by studying both the maximum transverse displacement and the end-shortening strain.
Universal vaccines are used as an alternative approach for improving immunogenicity and cross-protection against emerging strains, shortening production time, and reducing side effects [ 24– 26].
As a result, under high strain-rate compressive loading, the strain level at the damage initiation was shortened with increasing strain-rate.
Distal to this in bin, the ATACCCGTACCCGTACCCAT sequence in the Russian 2b strain was shortened to ATACCCGTACCCAT in the Celera strain but absent altogether in the Oregon R strain.
Furthermore, the gE-negative BoHV-1 vaccine shortened the challenge strain shedding.
Using the merged FUSI USP process, the FUSI gate can be processed with the source/drain region silicide in one step, and the poly gate can be thinned to less than 300 Å, thus shortening the distance between the strain contact etch stop layer and the channel to generate higher stress.
Dr. O'Neill, who received $7 million, hopes to find a life-shortening wolbachia strain in fruit flies or to create one by gene modification, and use it to infect mosquitoes, which now harbor benign strains.
This study focused on load-carrying capacity, column shortening, longitudinal strains in strips and stirrups, ductility, and stiffness factors.
The fall of 2016 was the latest freeze-up ever for these bears, shortening their seal-hunting season and straining the limits of their fat reserves.
