Sentence examples for shared perfect from inspiring English sources

Suggestions(1)

Exact(2)

We mapped immediately upstream from the AP-1 site a GC-rich region located at positions -41/-36 (GGGGCGGAA) that shared perfect homology to the consensus Sp-binding sequence (5'-[G/T]GGGCGG [G/A] [G/A]-3') [ 8].

For example, one 23 nt-long motif (CGTACTTCAGCCTGGGCAACAAG) that shared perfect sequence identity with three adenoviral genomes and considerable identities - with five other adenoviral genomes, was included in a variant of human transposable element of AluS family and was represented in the genome by multiple copies.

Similar(58)

They take turns playing songs, sharing perfect harmonies and easy banter, their mutual appreciation bringing out the best in their varied styles.

Facebook, of course, also owns Instagram — a service that's all about sharing perfect pictures.

Sipping Tecate with friends while sharing perfect guacamole and tacos al pastor is the ideal way to spend a warm afternoon (if you were lucky enough to snag a table).

Our within-species results from D. melanogaster add evidence that this quantitative relationship persists even when the additional copies do not share perfect sequence identity.

Also, several sequences of 20-25 nt located within Arabidopsis intergenic regions share perfect or near perfect complementarity with a variety of plant virus genomes, but have not been validated as miRNAs yet [ 27].

Three unidirectionally cloned ESTs (accessions CD585878, CD585963 and CD596001) were all revealed upon sequencing to correspond to a 914 nucleotide long cDNA sharing perfect complementarity to nucleotides 2701 3614 of the grna cDNA (Additional File 11, panel A).

This mismatch was due to the fact that zip codes and counties do not share perfect overlap, so the PrimeLocation classification system did not include some of the zip codes which were not fully contained in the county borders.

There, she meets Ray Paul Sparkss) — or re-meets him: twenty-five yeago ago, they shared a perfect, fleeting makeout session on the beach.

Posada jogged to left-center field to stretch before last night's game and tried to keep his distance from Wells, with whom he shared a perfect game in 1998.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: