Sentence examples for set sequences from inspiring English sources

Students also practice basic sparring combinations (id-bo tueryon, "one-step sparring"); these are short, set sequences of attack and counter practiced between partners, after which the students may practice free sparring as opponents.

To track multiple people (together with their multiple body parts) in video, we use the CAVIAR [39] data set sequences.

With the opening of the High Line Park, many films and television shows have set sequences there.

We align the core set sequences using MUSCLE [19] and, using HMMER (hmmbuild command), build the core profile.

The proportion of the test to train set sequences on this tree was chosen as the optimal after testing several other proportions for the accuracy of predictions.

The primer set sequences were HCV-F1: CTC CAG GTG AGA TCA ATA GG and HCV-R1: CGT GAC TAG GGC TAA GAT GG.

The option of having the training set sequences "shuffled" provided one of the controls used, ensuring that the motif(s) we detected were significant.

Probe set sequences were also compared to the nonredundant Genbank database by BLAST (NCBI, Bethesda, MD, USA) to confirm the current most representative public ID and annotation for cattle.

Plasmid DNA PTPRZ1-EBS4D and EBS5D with deletion of Ets-binding core motifs GGAA were generated by using the same technique and primer set sequences as follows: 5' primer (5' CAAAAAAAACATTTCGCTCCCCCTCCCTCTCC 3'), and 3' primer (5' GGAGAGGGAGGGGGAGCGAAATGTTTTTTTTG 3').

A leave-one-out cross validation was performed excluding each one of the Gold Standard data set sequences and blasting it against the remaining sequences using BLAST2P search (version 2.2.10,[25]) with default parameters (Blosum62, Gap open penalty: −1, Gap extension penalty: −1, Expected value: 10).

Plasmid DNA PTPRZ1-2138M5, -1655M5, -1059M5 and -250M5 with a mutagenized HRE5 were generated by using the same technique and primer set sequences as follows: 5' primer (5'-GAAGCAGAGGAGCCGCTTTGCGAGGGGCCGCAGA-3'), and 3' primer (5'-TCTGCGGCCCCTCGCAAAGCGGCTCCTCTGCTTC-3') (HRE5 wild type sequences were mutated from GCACG to GCTTT).