Your English writing platform
Discover LudwigExact(4)
To further verify the killing of live A. hydrophila by the embryos, PCR analysis was performed using a primer set (sense primer, 5'- AATACCGCATACGCCCTAC-3'; anti-sense primer, 5'- amplifyingCTCaCGACAC-3') amplifying a specific region of A. hydrophila 16S rRNA gene.
Microsatellite instability analysis was performed using the BAT25 primer set (sense, 5′-TCGCCTCCAAGAATGTAAGT-3′ and antisense, 5′-TCTGCATTTTAACTATGGCTC-3′) and the BAT26 primer set (sense, 5′-TGACTACTTTTGACTTCAGCC-3′ and antisense, 5′-AACCATTCAACATTTTTAACCC-3′).
PCR products were generated using the following primer set: sense primer (5'TGenBankGAF365927GAGGGT3', Genucleotides927 nucleotides 545 567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782 803).
Quantitative PCR was performed with a hexon-specific primer set: sense, 5′-ATG ATG CCG CAG TGG TCT TA-3′, antisense, 5′-GTC AAA GTA CGT GGA AGC CAT-3′ and the FastStart DNA Master SYBR Green I kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol.
Similar(56)
Since is a totally ordered set, makes sense and (2.2).
Make your skill set make sense for non-profits and activist groups.
You can set Storage Sense to run automatically but you can also configure and run it whenever you want.
The idea itself is nothing new, having a DVR and HD tuner built-in to the TV set makes sense.
Check to make sure the threshold you have set makes sense relative to the size of the events you are recording and the noise level.
His striking dress sense was set off by a gap between his two upper front teeth.
Whether the camera is fixed on players drilling with spartanly minimal equipment or the faces of primary school children making their first forays into English, the common denominator is a deep-set sense of community which makes life in Ritoma possible.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com