Sentence examples for set leaving from inspiring English sources

An hour later, it has become a dim range of blue hills, and when I look outside I find that the moon has set, leaving a nocturnal panorama of stars so brilliant that it casts shadows under the trees.

The high-tariff weeds out the chunky cruise-ship set, leaving a fairly sophisticated crowd.

Visibility was poor because the moon had already set, leaving no ambient light and no visible sea horizon.

(your local time), the moon will have finally set, leaving the sky completely dark for about an hour.

Thirty respondents were excluded from the modelling data set, leaving 199.

These patients were removed from the data set leaving 87 patients for further analysis.

The opening Gesualdo set left a listener with strong doubts about the enterprise.

Hsueh's experience on a film set leaves him optimistic about what is known in Mandarin as American-style Olive Ball.

Experience offered no reason to believe in it, but the momentum of the course Bush had set left no alternative.

Although the barebones set left much to the imagination, Bruce made the best of it with finely paced action.

Primer sequences: Control set (Left -TCCTCAAGTTTCCGCACAGT Right- GGCTGCCCATTTTGTATTGA, Product size - 82), Peptide 5 set (Left –TCAGTGGTCTTGGTGGCTTT, Right – CCACCATAGAGGCCAGAACT, Product size – 208), Peptide 3 set (Left – GCAGCAACCCCAACAAAC, Right – CCCTGCCCTCACCATATTCT, Product size – 75), Peptide 4 set (Left – CATTGGGGTGGGAAAAAGTT, Right – GGCCATTGTTGCACAGAGAG, Product size – 187).