Sentence examples for set base from inspiring English sources

The Department of Consumer Affairs said that a survey of nearly half of the 40 New York City outlets of the company, which has 2,400 stores nationwide, found that the stores set base charges for TV's, DVD players, stereo systems and the like as high as triple the manufacturers' suggested retail prices.

Second, for the vertebrate SWS1 data set, base frequencies were found to be fairly constant across the phylogeny.

Upon listing the probes most highly correlated with probe pm6 from the 31846_at probe set (base sequence TCCTGGACTGAGAAAGGGGGTTCCT) it becomes apparent that there is a common theme: each probe contains a sequence of four or more consecutive Gs.

Turn your plate upside down and set base on top.

Know that surfing/swimming in the waves can make you float far away from where you have set base.

3 Pour the slightly cooled caramel (don't let it cool completely to room temperature, or you might find it too thick to pour) into the set base.

October 2, 1932 Washington, D.C., United States Maury Wills, byname of Maurice Morning Wills (born October 2, 1932, Washington, D.C.) American professional baseball player and manager, who set base-stealing records in his playing career.

The cap figure is set based on revenues.

And group insurance rates are not set based on medical history at all.

A 20-piece porcelain dinnerware set, based on the same painting, is $145; mugs are $15 each.

Some accountants say the value should have been set based on prices when the deal closed, not weeks earlier.