Your English writing platform
Free sign upExact(1)
Although it has been typically preferred to use an inbred individual for genome sequencing to simplify assembly, the possibility of high-coverage sequencing-by-synthesis makes it possible to assemble even with potentially high levels of variation [ 3].
Similar(57)
The only other restrictions on clone selection were 1) the presence of both a polyA tail and a XhoI restriction site at the 3' end of the coding sequence to simplify linearization of cDNA and 2) a size of 1400 to 1800 bases.
Given the high number of sequences, we excluded from this alignment some sequences to simplify the tree, in particular the more divergent ones, such as those from the leech Helobdella.
It has the advantage of addressing plausible pathologies in a predetermined specific sequence designed to simplify clinical reasoning.
Unique KpnI and HindIII restriction sites were incorporated at the 5' and 3' ends of the sequence, respectively, to simplify directed cloning into KpnI and HindIII sites in the reporter vector pGL3-basic (Promega).
MEGA can then use this sequence to run a BLAST search to probe GenBank for other similar sequences (it is best to use a protein sequence that recovers one or very few sequences per species to simplify tree reconstruction. If too many sequences per species are encountered at this step, select an alternative gene).
To simplify the sequencing data, all identical sequence reads in the small RNA library were grouped and converted into sequence tags.
To simplify the sequencing data, all identical sequence reads in each small RNA library were grouped and converted into sequence tags–unique sequences with associated counts of the individual sequence reads.
To simplify the sequencing data, the identical sequence reads among the 6 small RNA libraries were grouped and converted into unique sequences.
New-generation genome sequencing technologies have the potential to simplify this task.
The GP5+/6+ primers [ 9, 10] were modified by the addition of SeqA2 (GAATTCTCTAGATGATCAGCGGC) or Seq B2 (CGAACTTTATTCGGTCGAAAAGG) tags to their 5′ ends to simplify later sequencing.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com