Sentence examples for sequencing is for from inspiring English sources

Exome sequencing is, for all intents and purposes, the same as hybridization targeted capture in methodology.

We evaluate how effective 20mer tag sequencing is for identifying candidate genes and biological processes when (a) a distant but well annotated transcriptome (TAIR10 release of Arabidopsis thaliana) is used as a reference, (b) when a reference transcriptome for P. fastigiatum generated with RNA-seq is used, and (c) when partial sequences instead of full length transcripts are used.

"The City" is not the advertisement for New York that "The Hills," with its dreamily shot opening-credit sequence, is for Los Angeles.

But one little bomber got through, whatever the gene sequence is for the Phillips ability to make a horse jump over a hurdle.

A typical choice for a step size sequence is for instance for some.

The proper sequence is for government to keep spending until jobs and growth are restored, and only then to take out the budget axe.

Primer sequences were as follows: forward, GCACGATCAGTTCAAGGCAAC; reverse, GCTGAGGGTGATGTAGGGATTG. Probe sequences were for C1747T: forward, VIC-CGAGGCTGACCGAGAG; reverse, FAM-CCGAGGCTGACTGAGAG.

The genomic DNA sequences are used for Bowtie 2 mapping whereas the CDS sequences are for other following procedures.

Much more sequencing is necessary for WGS.

Such sequencing is readily affordable for Drosophila.

Shotgun sequencing was performed for the clone.