No onlooker would assume that the choreography in a theatre show, or the fight sequences, were the work of the director alone.
Specific primer sequences were the following: rPAC-forward (5′ CCCCATGGCTAGCGAGGACCGGCC) and rPAC-reverse (5′GTGCTCGAGTTAATTTGGCGGATTGC), including the restriction sites for NcoI and XhoI, respectively.
In most of the 4 billion years of life on Earth, gene sequences were the only way information was encoded for evolutionary purposes, said Nowak, who is the director of Harvard's Program for Evolutionary Dynamics.
Consensus readings of all sequences were the reference standard.
Other abundantly present members among the Gammaproteobacterial sequences were the genera Enterobacterium and Vibrio.
Gradient-echo (GRE) sequences were the first 3D sequences used for cartilage imaging [4, 7, 8].
The selected sequences were the four most visited videos of YouTube history until 2015 [34 37].
Another abundant phylum within our amplicon sequences were the Verrucomicrobiae (including subdivision 3 and 4 (Optitiae)).
The GH catalytic modules corresponding to 11,010 sequences were the most predominant and represented 96 different families altogether.
The image acquisition sequences were the time of repetition (7.3 ms), echo time length (2.8 ms), and flip angle (6°).
In addition, five behavioral sequences were the same as week 2: ES → ES, ND → ND, RE → RE, OT → OT, MP → CC.
