Sentence examples for sequences the one from inspiring English sources

And the bold, sweeping inventiveness of action sequences, the one thing that American movies consistently do well, has grown over the years.

There are weaker sequences: the one about the sexism of vintage children's fiction (Janet and John, etc) doesn't demonstrate its points very effectively.

Out of different sequences, the one that optimizes the total energy consumption is chosen as the best candidate for surmounting a given step-like obstacle.

Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.

In the DSAQFA method proposed in our earlier study [7], test subjects are instructed to select from a range of adjustable quality sequences the one that matches as closely as possible the subjective quality of a fixed reference sequence.

If there was a tie between 2 assembled sequences, the one with the largest sequence identity was selected.

To measure the similarity between two activity sequences, the one-dimensional Sequential Alignment Method (SAM) is used to compute the Levenshtein distance between two sequences of activities by applying a dynamic programming algorithm [23, 24].

Among these sequences, the ones found in intergenic regions were predicted to be potential attP sites.

Moreover, among the few available gB sequences, the ones most similar to our isolate belong to the same Suborder (Caniformia).

The sequence you typed is unlikely to arise by chance alone, and it matches an independent target sequence (the one written by Melville).

Among the ten models built for each fungal MIP sequence, the one with the optimum MODELLER objective function was selected.