Sentence examples for sequences that directly from inspiring English sources
Successful pulse sequences that directly target the dipolar interactions cannot be applied to paramagnetic metal centers with fast relaxation rates and large g-anisotropy, if no echos can be detected and the excitation bandwidth is not sufficient to cover a sufficiently large part of the spectrum.
Qigong is roughly translated as "energy development," and there are many forms, from very simple arm movements and waist rotations to complex sequences that directly engage the spine, joints, fluids and organs, as well as the body's "chi," or inherent energy.
Using cDNAs as sequencing templates reduced data complexity compared to whole-genome sequencing and enabled marker discovery in expressed sequences that directly delivered candidates for the trait of interest.
More difficult to ascertain is the presence of 3 additional Italian sequences that directly sprout from the basal node of the west sub-Saharan African clade U6a5 (12.7 kya).
A reverse primer, RPH-134 (ATTTGTTTGACAGTCTCTAAC), corresponded to the 5' region of exon II, the sequence that directly follows the 5'UTR intron.
LTRs are up to 5 kb-long sequences that are directly repeated at the 5' and 3' ends of these elements [4].
In particular, these analyses allowed us to identify and eliminate sequences that were directly related to non-Brazilian sequences suggesting that they had been imported from localities outside of Brazil.
This could guide us to identify conserved motifs in the FAEs sequences that are directly connected with functional characteristics of the respective enzyme and to develop models that are able to elucidate the underlying structural characteristics that determine substrate specificities.
Substrates often contain recognition sequences that bind directly to one or more WW domains.
To identify sequences that interact directly with centromere proteins, we carried out chromatin immunoprecipitation using antibodies to centromeric histone H3 (CENH3), a defining feature of functional centromeric sequences.
Besides these signal sequences that are directly involved in splicing, other features are also related to intron recognition, including intron length and nucleotide composition within the intron [ 5].
