Your English writing platform
Discover LudwigSuggestions(1)
Exact(34)
The player can initiate brief slow-motion sequences that allow fast aiming at slow-moving targets, an entertaining feature reminiscent of the "Matrix" sequence from Conker's Bad Fur Day.
Integrons are strips of DNA containing repetitive nucleotide sequences that allow genes from one organism to be used by another.
By using phase-shifted pilot sequences that allow the separation of the different CIRs, the same result holds in the present model.
So the researchers took the small genetic sequences that allow SIV to dodge those blocks and stitched them into HIV-1.
In addition, each oligonucleotide is tagged at the 5′ and 3′ ends with distinct nucleic acid sequences that allow for the design of complementary primers for polymerase chain reaction amplification.
This makes it possible to design load sequences that allow very small advances of crack growth to be measured post-test by Quantitative Fractography, at growth rates well below the conventionally recognised threshold of the aluminium alloy examined here.
Similar(26)
We complement this result by developing an analogue of the so-called sequences of eigensteps from finite frame theory in the context of SG Bessel sequences, that allows for a detailed description of all sequences with prescribed fine structure.
Such adaptation would require the development of promoter sequences that allowed transcription by nuclear polymerases, and the establishment of 3'signals that could be recognised by nuclear polyadenylation functions.
Specimens that were still recalcitrant were then amplified with the primer combination LepF2 (or C_tRWF_t1) with MHemR and MHemF with LepR1 to generate shorter overlapping sequences that allowed the creation of a composite sequence.
In cases where a 650 bp product was not successfully generated, internal primer pairs (LF1 ANTMR1-(see Table 1)) and (MLF1 – GCTTTCCCACGAATAAATAATA [11] – LR) were employed to generate shorter overlapping sequences that allowed the creation of a composite sequence (contig).
DTW finds an optimal match between two sequences that allows for compressed sections of the sequences.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com