Sentence examples for sequences of use from inspiring English sources

Results also revealed different sequences of use of SRL strategies between prior knowledge groups, and that students spent different amounts of time engaging in SRL processes; however, all students visited similar numbers of relevant pages.

Sequences of used primers are included as supplementary information (Figure S 11).

Sequences of used annealer oligonucleotides are CTAACTATGGC-TACACCTTCGGTTT (Fig. 2, 3), AAACTGCTGGCACAGAAGTACACTT (Fig 2d,e), ACTATGGCTACACCTTCGGTT (Fig. 4) and CTACGAGCAGTACTTCGGG (Fig. 5).

Sequences of used primers.

Sequences of used siRNAs are listed in Supplementary Table S1.

The sequences of used primers are presented in Additional file 1: Table S1.

Whether the sequence of use goes "alcohol, marijuana, cocaine, then heroin" or "alcohol, marijuana, methamphetamine, prescription opioids, then heroin," or some other way, the result is the same.

Crossover studies were included if the sequence of use of intubation devices was randomized.

The target sequence of the used ERβ siRNA was 5′-CAGCGATTACGCATCGGGATA-3′, and the sequence of used GPR30 siRNA was 5′-CGGCCACGTCATGTCTCTAAA-3′.

Sequences of primers used in this study.

Sequences of oligonucleotides used as probes and competitors are depicted.