Sentence examples for sequences of use from inspiring English sources

Exact(1)

Results also revealed different sequences of use of SRL strategies between prior knowledge groups, and that students spent different amounts of time engaging in SRL processes; however, all students visited similar numbers of relevant pages.

Similar(59)

Sequences of used primers are included as supplementary information (Figure S 11).

Sequences of used annealer oligonucleotides are CTAACTATGGC-TACACCTTCGGTTT (Fig. 2, 3), AAACTGCTGGCACAGAAGTACACTT (Fig 2d,e), ACTATGGCTACACCTTCGGTT (Fig. 4) and CTACGAGCAGTACTTCGGG (Fig. 5).

Sequences of used primers.

Sequences of used siRNAs are listed in Supplementary Table S1.

The sequences of used primers are presented in Additional file 1: Table S1.

Whether the sequence of use goes "alcohol, marijuana, cocaine, then heroin" or "alcohol, marijuana, methamphetamine, prescription opioids, then heroin," or some other way, the result is the same.

Crossover studies were included if the sequence of use of intubation devices was randomized.

The target sequence of the used ERβ siRNA was 5′-CAGCGATTACGCATCGGGATA-3′, and the sequence of used GPR30 siRNA was 5′-CGGCCACGTCATGTCTCTAAA-3′.

Sequences of primers used in this study.

Sequences of oligonucleotides used as probes and competitors are depicted.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: