Sentence examples for sequences of the used from inspiring English sources

The sequences of the used substrates were designed according to literature data for being specific for 10 of the caspases.

Sequences of the used primers are for Jak2 TGAAGACCGGGATCCTACACACAGTT (forward) and GTCATACCGGCACATCTCCACAC (reverse), for βTrCP2 CATGTTGCAGCGGGACTTTATTACC (forward) and GATCACTCGCTGCCATTCTTTACAT (reverse), for Rps19 CCTTCCTCAAAAAGTCTGGG (forward) and GTTCTCATCGTAGGGAGCAAG (reverse), for β-actin.

The sequences of the used oligonucleotides have been published previously.

The sequences of the used qRT-PCR-Primer are shown in Table S2.

The sequences of the used primers are listed in Table  1.

Sequences of the used primer pairs are shown in Table 2.

The target sequence of the used ERβ siRNA was 5′-CAGCGATTACGCATCGGGATA-3′, and the sequence of used GPR30 siRNA was 5′-CGGCCACGTCATGTCTCTAAA-3′.

Only helix II could be modeled throughout the set of sequences independent of the used sequence-structure pair.

The sequences of the primers used for the qPCR experiments are presented in Table 2. Melting curve analysis was used to ensure the specificity of each primer pair.

The DNA sequences of the primers used for qPCR were described previously39.

Alignment of translated amino acid sequences of the HD used in comparative modeling (C).