Other television sequences may have caved in and gone for the tirade approach about the intricacies of how a wave is done right an exposition for the explanation but not in this show.
However, the 5' enhancers and other regulatory sequences may have been affected during subsequent duplication steps.
For the plants, 139 and 136 ITsequencesces may have been fungal sequences, as determined by BLAST and HMM, respectively.
Repetitive sequences may have been missed in these sets of sequences but they are thought to be scarce in fungi [33], [34].
Because ratios around 1 implicate absence of both positive and purifying selection, this indicates that the S. conica and S. conoidea sequences may have lost their function.
DNA sequences encoding "chelatase" homologs are often apparent pseudogenes, partial sequences, or sequences containing one or several internal stop codons, suggesting that such sequences may have experienced insertion and subsequent excision of DNA fragments.
The absence of COOH-tail sequences may have resulted in a receptor that lacks sequences necessary for mediating rapid desensitization and internalization as well as strong plasma membrane expression (PME) [8].
It is plausible that the GRD sequences may have been derived from a now extinct begomovirus lineage that was not more closely related to the present-day NW begomoviruses than they were to present-day OW begomoviruses.
Based upon the diversity analysis, we also concluded that while 387 sequences may have been insufficient to characterize all phylotypes present, they were sufficient to estimate the overall microbiota diversity in all samples.
The signature sequence - 5'TTTAATTCGAAGCAACGCGAAGAACCTTA3' - shared by all the Clusters except 5 and 7 also indicates that these sequences may have a common origin similar to Lactobacillus, Paenibacillus, Clostridium, rumen bacterium, etc. [105].
Secondly, many chimeric sequences may have been removed because of the strict requirement for proper sequence tag and primer sequences on the left and right ends, and because of a requirement for long overlapping segments of a defined length.
