Your English writing platform
Discover LudwigSuggestions(1)
Exact(28)
The munged reads were then mapped using Maq v0.7.1 [ 27] to reference sequences comprising the specific amplified sequences plus M13(−21) and four-fold munged barcodes of the occupied address space.
Variability in integrase sequences comprising the assay target regions from >1000 clinical specimens submitted for phenotypic and genotypic raltegravir resistance testing were analyzed.
Oligonucleotide sequences comprising the exonic and intronic Sam68 binding sites were AUAGACAGAAUCAGCACCAGUGCUCAUGGAGAAAAUUGGACC and GAAGAAGAGGAUUAUUAAAGACUAUUUGAUUAGA, respectively.
Rickettsial protein sequences comprising the 731 core representative OGs (dataset 1) were exported from the PATRIC database and aligned locally using default parameters in the command-line version of the program MUSCLE [179], [180].
The TAAT sequences comprising the core regions of conserved palindromes and direct repeats in both IREs are canonical binding sites for homeodomain (HD) transcription factors, which are generally involved in the regulation of development and cell fate but also function post-developmentally to modulate cell type specific gene expression.
The length distribution of the binding motifs in the model genome was derived from the yeast data provided by Harbison et al. [9], where the motifs were reported as letter sequences comprising the symbols for the four bases {ATGC}, or the symbols {YMKRSW} signifying a preference for any two out of four bases, etc., with the corresponding lower case letters indicating a lower confidence level.
Similar(32)
Mixed A and Mixed B video sequences comprise the first 50/100 frames of the specified QCIF and CIF videos, respectively, as shown in Table1.
Thick loess deposits consisting of paleosol sequences comprise the deep regolith of the Palouse region in eastern Washington and northern Idaho.
Notably, the HaCR sequences comprised the largest number of ESTs among the selected pathogenicity factors (Table 1), indicating that this class of effectors is highly expressed during infection.
These representative sequences comprise the set of unique sequences from the dataset.
The human RefSeq sequences comprised the second data set for the analysis, group b.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com