Sentence examples for sequence which has been from inspiring English sources
A sharp departure from cinematic convention was the six-minute opening sequence, which has been described as one of the longest extreme close-ups of a major star ever filmed.
Therefore, we transform the binary masks as if they were estimated from a sequence which has been recorded by a camera with top view.
An overload has been introduced into the LCF cycle component of the test sequence, which has been based on a ratio of HCF to LCF cycles of 1000 1.
We chose the minigastrin11 (MG11) analogue ([D-Glu1, desGlu2 6]−minigastrin, minigastrin = Glu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe-NH2) as a model targeting sequence which has been widely characterised with other chelators including HYNIC and DOTA [10, 11].
shRNA DISC1 #1: GGCTACATGAGAAGCACAG shRNA DISC1 #2: CAGCTGGAGGTCACTTCCTT shRNA DISC1#1 is a previously validated sequence which has been shown to target mouse DISC1 [44].
This is analogous to the detection of a foreign virus sequence, which has been applied as a useful biomarker for Epstein-Barr virus associated nasopharyngeal carcinoma [45], [46].
In this section, we review the definitions of (uniformly) almost periodic, asymptotically almost periodic sequence, which have been discussed by several authors and present some related properties.
The first is to use some famous sequences, such as the Golomb sequence [8], Frank sequence [9], and a pseudo random sequence, which have been proved with low sidelobes and applied in the radar systems successfully.
The sequence-order features can be used for representing amino acid distribution patterns of a specific physicochemical property along a protein or peptide sequence, which have been used for predicting protein subcellular locations.
The facts are therefore searched for evidence to support the particular hypotheses which may explain the event sequence (which have been generated in response to a predefined trigger event).
The resulting construct was digested with NotI and AflII to insert a polyadenylation addition sequence, which had been excised from pEGFP-1 (Clontech) using NotI and AflII.
