Sentence examples for sequence upstream from inspiring English sources

This method initially lists every 8-bp sequence upstream of regulated genes as candidate sequences.

A highly conserved sequence upstream of the transcriptional enhancer in the U3 of murine leukemia viruses (MLVs) was reported to mediate negative regulation of their expression.

We found that the sequences CGCC and GCC were often attached to a TATA-box sequence upstream of Fe deficiency-upregulated genes.

Since most TFBSs reported are less than 8 bp in length, this method initially lists every 8-bp sequence upstream of regulated genes as candidate sequences.

Forward primer (ACGTCATATGAATCATTTTATAGACGTTGAGATTCC) hybridized to a sequence upstream of comQ contained a NdeI site while downstream comX was amplified by reverse primer (ACGTGGATCCTTATTTGAACCATAAATTAGGGTAAG) containing a BamHI site.

Primers were designed to include an intact Kozak sequence upstream of the translation start site.

The sequence upstream of omcZ was amplified with primers 2076-1 and 2076-2 (Table 1).

It contains a Kozak sequence upstream of ATG and no stop codon at the C-terminus.

Analysis of the DNA sequence upstream from the pA3732 gene allowed to identify a putative RpoN-binding site (Fig. 4C).

Therefore, we analyzed the DNA sequence upstream from the pA3732 gene and we could identify a putative RpoN-binding site.

We cloned about 1 kb of DNA sequence upstream of human optineurin cDNA sequence by designing appropriate primers.