Sentence examples for sequence segment from inspiring English sources

The represented sequence segment is 250 kb long in Nipponbare.

The sequence segment shown is 295 kb long.

In both cases, each example in the training dataset is a sequence segment corresponding to data from a single phoneme.

Sequence segment outliers that score below the threshold are annotated as 'discrepancies' or potential errors.

The hIKK-2 subunit is a polypeptide of 756 residues with a kinase domain in its 15 300 sequence segment.

The primer pair LpFBPF/R against the fibronectin-binding protein fbp gene was designed using the L. plantarum WCFS1 genomic sequence segment 6/11 (accession no: AL935257.1).

For sequences retrieved with e-value of 0.0001 or less in any of the PSI-BLAST scans, the sequence segment giving the lowest e-value was identified.

The CA3427 structure highlights a binding site located between the two protein domains, corresponding to a sequence segment conserved among fungi.

Each probe was selected from a sequence segment that is common to a maximum number of splice variants predicted for each gene.

1.5-kb 5'-flanking upstream the transcription start site (TSS) promoter sequence segment was amplified from genomic DNA using the 5' TACCAAGACCAGCAGCACAC and TAAGGAGATCCCTGCCCTTCTTC primers.

This matrix is used to score an alignment of the TFBS profile with a sequence segment of length W. The score function is additive, so that the score S of a sequence segment is evaluated by summing up residue scores of all site positions.