Sentence examples for sequence repertoires from inspiring English sources

Skylarks seem thus to rely on the composition of the syllable and sequence repertoires rather than on other acoustic cues to differentiate group members from strangers and to individually recognize their adjacent neighbours.

It is not known whether VSG sequence repertoires are expanding and/or diverging.

The salivary protein sequence repertoires available from public databases for both An.

= average ω estimate over residues with ω > 2. Sequence repertoires of loci from T. b. gambiense were consistently the least genetically diverse.

This low level of variation in the T. b. gambiense BES sequence repertoires is consistent both with the relatively narrow host range of this subspecies and its apparent long-term clonality.

With the exception of ESAG2, the BES sequence repertoires derived from T. b. gambiense are both less diverse than and nearly reciprocally monophyletic relative to those from T. b. brucei and T. equiperdum.

Using Sanger-based sequencing technology, we have accrued a sequence repertoire of more than 68,000 expressed sequence tags (ESTs), representing more than 28,000 unique CHO transcripts.

In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not.

Concerted evolution will then allow redistribution of repeat variants from this large WD-40 sequence repertoire between family members.

An oligonucleotide was synthesized by "mix and split" procedure which contained the complete (G2W5 4 sequence repertoire flanked by constant regions (tagrep; CCTTAATTAATACGACTCACTATAG(G2W5 4CCCGGGGG).

Hepatitis C virus, with its extreme variability of sequence repertoire, is a difficult target for vaccine design.