Sentence examples for sequence repertoire from inspiring English sources

Using Sanger-based sequencing technology, we have accrued a sequence repertoire of more than 68,000 expressed sequence tags (ESTs), representing more than 28,000 unique CHO transcripts.

In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not.

Concerted evolution will then allow redistribution of repeat variants from this large WD-40 sequence repertoire between family members.

An oligonucleotide was synthesized by "mix and split" procedure which contained the complete (G2W5 4 sequence repertoire flanked by constant regions (tagrep; CCTTAATTAATACGACTCACTATAG(G2W5 4CCCGGGGG).

Hepatitis C virus, with its extreme variability of sequence repertoire, is a difficult target for vaccine design.

Sudden spurt in sequencing projects in recent years has resulted in exponential increase in the genome sequence repertoire of species that are close relatives of many model organisms.

Skylarks seem thus to rely on the composition of the syllable and sequence repertoires rather than on other acoustic cues to differentiate group members from strangers and to individually recognize their adjacent neighbours.

The salivary protein sequence repertoires available from public databases for both An.

It is not known whether VSG sequence repertoires are expanding and/or diverging.

= average ω estimate over residues with ω > 2. Sequence repertoires of loci from T. b. gambiense were consistently the least genetically diverse.

This low level of variation in the T. b. gambiense BES sequence repertoires is consistent both with the relatively narrow host range of this subspecies and its apparent long-term clonality.