Sentence examples for sequence of mt from inspiring English sources

mtDNA 4295A>G occurs in an absolutely evolutionarily conserved sequence of mt tRNAIleu, reduces 3' tRNAse processing efficiency [57], segregates with multiple disease states [58] [60], and has been categorized as probably pathogenic [29].

The TMDQ evaluation was carried out by using two primers (tot mt S: CCATCTTTGCAGGCACACTCATC and tot mt A: ATCCACCTCAACTGCCTGCTATG) flanking a sequence of mt DNA known not to be susceptible to deletion [51] and an ad hoc designed FAM-labeled molecular beacon (mt tot: CGCGATCTCACGCAAGCAACCGCATCCATGATCGCG).

Thus, the exact sequence of MT dynamics changes after injury may vary between cell types and organisms.

Four of those sites are already T's instead of C's in the genomic DNA sequence of mt rps13 from Malus, and thus RNA editing might be expected at five sites in the Malus cDNAs.

The multiple sequence alignment of the various rice MT protein sequences (based on in silico predictions) with the protein sequence of MT gene cloned in our laboratory from Indica rice genotype Pokkali, OsMT1e-P [Genbank: EU684548] has been shown in Additional file 1: Figure S1A.

Locating the regions of the mt genomes associated with the replication origins (ORs, also known as control regions or A+T rich regions) for both "+" and "-" strands can be challenging based on a knowledge of the nucleotide sequence of mt genomes alone.

A comparison of the deduced amino acid sequence of MT-I and MT-II indicates 25% identity.

In addition, deduced amino acid sequence of MT-II also exhibits a high degree of similarity with type 2 plant MT-like sequences, with the typical cysteine-rich domains at the N-terminal (CCxxxCxCxxxxCxCxxxCxxC) and C-terminal region (CxCxxxCxCxxCxC), respectively (Branislav, et al., [2013]).

The result showed that the deduced amino acid sequence of MT-I have a high degree of similarity with type 1 MT-like proteins from other plants, including a central hydrophobic domain flanked by conserved cysteine-rich motifs (conserved domain 1 region: CxCxxxCxCxxCxC and conserved domain 2 region: CxCxxxCxCxxCxC).

Convergent degenerate primers, MET1 and MET2 (Table S1), were designed using the amino acid sequence of MT-1 [17].

Nucleotide sequence of mt-genome is a powerful molecular tool for resolving insect phylogenetic relationships at the level of the superfamily and family.