Sentence examples for sequence of mine from inspiring English sources

Exact(4)

Stable pole-to-pole oscillations which result in the time-averaged gradient of MinD are severely affected if the membrane targeting sequence of MinE is deleted.

DOI: http://dx.doi.org/10.7554/eLife.03949.007 10.7554/eLiFigure49.008 Figure 1 figure supplement 5. Deletion of the membrane targeting sequence of MinE affects pattern formation in micro compartments.

To gain a deeper insight in how the membrane targeting sequence of MinE contributes to gradient formation of the Min system we purified and labelled a MinE mutant without its membrane targeting sequence (MinE without amino acids three to eight, herein referred to as MinE Δ3 8)) and reconstituted it with MinD in microcompartments.

Depending on the degree of affecting the membrane targeting sequence of MinE, the effective generation of a gradient and its localization along the long axis of the cell might therefore be altered to different degrees, which might account for the distinct phenotypes in vivo, such as filamentous cells or mini cells.

Similar(8)

Due to the sequence of mining from top to bottom and the small interlayer spacing, the lower coal seams can benefit many times from the unloading effects.

These localized structural variations offer a rich source of sequences to mine for possible functional consequences, and to further our understanding of the mechanisms of copy number variation during genome evolution in plants.

In addition to the traditional variables related to the materials being extracted from the ground in the form of mining blocks, strips of ground following the dip of a pit are considered within the pit as decision variables, and the optimization process aims to optimally define both the sequence of extraction of mining blocks and the reservation of strips needed to store waste materials.

MinE without membrane targeting sequence (MinE Δ3 8)) was generated by deleting the coding sequence for aminoacids 3 8 of MinE of the overexpression plasmid for MinE (Loose et al., 2008) using a 'GeneArt, Seamless Cloning and Assembly Enzyme Mix' (Invitrogen, Life Technologies, Carlsbad, CA) and primers TTCCGCGATGCGAATTCGGATCCGCGACC and AATTCGCATCGCGGAAGAAAAACACAGCCAACA to obtain pET28a-MinE Δ3 8 pET28a-MinE Δ3 8

To prove the practical mining sequence of the result, some typical cross-sections of the mine plan are presented in Fig. 8.

Dates determined with three absolute dating methods (14C, luminescence and 230Th/U) supported the findings of the paleobotanical investigations of the Weichselian Upper Fluvial Sequence of the Scheibe opencast mine in the Niederlausitz (Lower Lusatia, eastern Germany).

One might take Everett's typicality measure to determine the subjective degree to which I should expect a particular relative sequence of records being (relative) mine, but to get even this would require careful explanatory amendments to Everett's presentation of the theory.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: