Sentence examples for sequence is for from inspiring English sources

"The City" is not the advertisement for New York that "The Hills," with its dreamily shot opening-credit sequence, is for Los Angeles.

But one little bomber got through, whatever the gene sequence is for the Phillips ability to make a horse jump over a hurdle.

Knowing what the comparable gene in Arabidopsis is, and what it does, gives Ceres and its competitors a short cut to help them decide how their own genes might work in a crop species.The Arabidopsis sequence is, for the moment, the only one in the garden.

A typical choice for a step size sequence is for instance for some.

The third to sixth conditions can provide a good designing criterion regarding what the best sequence is for reinforcing seawater or air attacked concrete structure by composites.

This process sequence is for avoiding high-temperature cycles on the as-deposited high-k film so as to suppress the growth of the interface silicate layer.

Exome sequencing is, for all intents and purposes, the same as hybridization targeted capture in methodology.

Primer sequences were as follows: forward, GCACGATCAGTTCAAGGCAAC; reverse, GCTGAGGGTGATGTAGGGATTG. Probe sequences were for C1747T: forward, VIC-CGAGGCTGACCGAGAG; reverse, FAM-CCGAGGCTGACTGAGAG.

The genomic DNA sequences are used for Bowtie 2 mapping whereas the CDS sequences are for other following procedures.

No rhythmic sequence is sustained for long.

A single sequence is enough for Mr. Oshima to establish the political context and the lovers' position within it.