Sentence examples for sequence illustrations from inspiring English sources

Exact(1)

Ask students to use their sequence illustrations to explain where and how the drug interrupts the H.I.V. life cycle.

Similar(59)

Is it helpful to create a sequence of illustrations, as opposed to a single diagram (PDF)?

All of the above thoughts and conclusions on the nature of material cultural evolution and its similarities to, and differences from, biological evolution are summarized in the following sequence of illustrations highlighting major features of cornet history and evolution.

Table 4 Sequences and indications T1 SE/FSE Excellent sequence for illustration of anatomy, bone marrow (conversion), fat content, haemorrhage, calcifications, fracture line, tumor margins, soft tissue.

The dating of the sets is unknown, as is Blake's intended sequence for the illustrations.

The sequence of the illustrations is also a topic of scholarly dispute: the mountings of the Thomas set were inscribed on their backs with numbers 1-6, buthesese were added during or after the 1872 Sotheby's sale, and so are unlikely to follow Blake's intended order.

Most unconvincing of all is a sequence of photo-illustrations from a book called It's Time to Get Up by F Folman and V Bonyuk, in which boys and girls aged about six parade about in paper hats and shorts, carrying placards or wearing Red Cross armbands.

(B) Schematic illustration of sequence structure of TTAS products.

From the illustration, a sequence of M frames, y 1,y 2,…,y k,…,y M, is first captured by an imaging device.

TIRM sequences allow excellent illustration of the anatomy and detection of inflammation in the bone marrow.

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: