Sentence examples for sequence forward from inspiring English sources
Sequence forward and reverse reactions were run on a 3100 automated Capillary DNA Sequencer (PE Applied Biosystems).
After that, each sequence (forward) was compared to its complement (reverse) and then adjusted manually to get one sequence.
To isolate human ACAT-2 genomic DNA, we designed primers based on the human ACAT-2 cDNA sequence: forward primer 5′-ACACCTCGATCTTGGTCCTGCCATA-3′ and reverse primer 5′-GGAATGCAGACAGGGAGTCCT-3′.
PCR were carried out on genomic DNA from each sample to amplify genes coding for bacterial 16 s rRNA using 16 s primer sequence; Forward: 5′-CCTACGGGAGGCAGCAG-3′ and Reverse 5′-CCGTCAATTCCTTTRAGTTT-3′.
It's all about the major punch, kick, and gunshot that move the sequence forward.
Oligonucleotides were purchased from MWG and had the following sequence: forward – 5'-CGCAATCTGACAATGCGCTCATCGTCATCCTCGCGACGCG-3', reverse – 5'-CGCGTGCCGAGGATGACGATGAGCGCATTGTCAGATTGCG-3'.
The organization of weight and bias memory is shown in Figure 7, and the addresses are allocated based on the priority of data sequence forwarding for successive computations.
Ninety-six positive clones were sequenced forward and reverse in an ABI Prism 3100 automatic sequencer (Applied Biosystems, Foster City, California, USA), and 44 sequences were suitable for primer design.
12 Chinese undergraduates were asked to recite overtly but gently numerical and alphabetical sequences forward and backward.
Offspring was tail snipped and genotyped using PCR with primers specific for the APP-sequence (Forward:"GAATTCCGACATGACTCAGG", Reverse: "GTTCTGCTGCATCTTGGACA"). Positive heterozygous animals and negative wild type littermate controls were used for the experiments.
Primers for amplification of Ec042-2242, 4511 and 4803 alleles possessed the following sequences 5' CTGAGCTCCGTGAACAGTTTACCGGTGC-3' (forward primer), 5'-CAGAAGGTCCCGGCCACACCCCCGTTTTTGACA-3' (2242), 5'-GGCCGGGACCTTCTGACAGAACCATCGCCTCTC-3' (4511) and 5'-TTTCTAGATCATCAGGTGTGAATGACAGG-3' (4803).
