Sentence examples for sequence catalog from inspiring English sources

SAGE software excludes replicate ditags from the tag sequence catalog because the probability of any two tags being coupled in the same ditag is small, even for abundant transcripts.

A scrambled siRNA nucleotide sequence (catalog number 1022076; Qiagen) with no significant homology to any mammalian gene (sense: UUC UCC GAA GUC ACG UdTdT; and antisense: ACG UGA CAC GUU CGG AGA AdTdT) was used as a negative control.

An annotated genome enlists the putative genes and their sequence catalogs.

We have reached a level of saturation regarding 16S rRNA sequence catalogs of gut microbiota from the Western population.

Among them 05 filamentous fungi were selected and characterized based on colonial morphology, 18S rDNA sequence cataloging and microscopic analysis using lactophenol blue staining method [ 59, 60].

In a similar approach than the one proposed in this study, Verspoor et al. (2012) successfully used metadata about a protein sequence cataloged in the Protein DataBank to filter candidate protein residues detected in corresponding PubMed abstracts.

Gag peptides included clade B consensus and DU422 sequences (catalog #8117 and #6869).

Our framework for lincRNA candidate selection for genetic analysis, based on RNA-sequencing catalogs and genomic studies, has led us to unexplored roles for lincRNAs in brain development.

Sequences of ADAMTS homolog sequences presented here were identified from 2001 to 2004 using genomic sequences cataloged in the NCBI, JGI (Fugu and Ciona [ 52, 70]) and Celera genome databases using BLASTp, BLASTn, BLASTx, tBLASTn and tBLASTx searches [ 71].

The data from these studies, including the genome sequences, catalogs of sequence variants, sets of coevolved gene clusters, and PASS regions across 27 rat strains, represent a step change in the genome resources available for study of complex phenotypes in the rat model.

Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no.