Sentence examples for sent for use from inspiring English sources

Of these inputs, 93.3 Mtoe is either exported or sent for use in shipping following the first stages of processing.

More than 1,000 of those who were killed after passing through Tuol Sleng died when they were drained of blood, which was then sent for use in hospitals.

A number of reverse dies with an S mint mark, intended for the San Francisco Mint, were created in 1955; they were not used as that mint struck no nickels that year and subsequently closed, and the unused dies were sent for use at Denver, where the S mint mark was overpunched with a D. 1949 and 1954 are other years where one mintmark was punched over another.

This comes as RAF Tornado jets are to be sent for possible use in a northern Iraq aid operation, as thousands of people flee from Islamist fighters.

They come as RAF Tornado jets are being sent for possible use in aid operations to help the thousands of people who have fled from Islamist fighters.

Plasmids from each sample was purified using commercial plasmid preparation kit (Promega, USA) and sent for sequencing using M13 forward and reverse primers.

Plasmid DNA was extracted using NucleoSpin Plasmid (Macherey Nagel) kit according to manufacturer's instructions and sent for sequencing using a CMV primer (gtacggtgggaggtctatataagcag).

All cloned fragments in both transformation steps were sent for sequencing using the T7 primers (Novagen) to determine the accuracy of their sequence.

The validated library was sent for sequencing using a single lane on an Illumina GAII.

Plasmid DNA was isolated from these cultures and sent for sequencing using the "T3 sequencing" primer (Supplemental Table 26).

Interviews were audio recorded, and sent for transcription using encrypted files and a secure file transfer system.