Sentence examples for sense sequence from inspiring English sources

Exogenous delivery of phosphorothioate AS ODNs between 0.01 and 0.5 μM significantly inhibited parasite growth compared with sense sequence controls suggesting sequence specific inhibition.

The complementary sense sequence was used as a negative control probe.

Control morpholino oligos comprised (a) a random sequence of the same length and (b) the sense sequence of the experimental Cnox gene morpholino oligos (e.g. [40]).

The sense sequence is 5'-GAGCTCTTGGTGGATCATC-3'. SiRNA was transfected into cells cultured in 6-well plates using Lipofectamine 2000 following the manufacturer's instructions (Invitrogen, Carlsbad, CA).

SPARC sense sequence was 5′-GTGGGCAAAGGGAAGTAACA-3′ and SPARC anti-sense sequence 5′-GGGAGGGTGAAGAAAAGGAG-3′.

The SiRNA sequences are: s13295, sense sequence AGUGGAAACUUUUGUCGGATT and antisense sequence, UCCGACAAAAGUUUCCACUCG; S13296, sense sequence ACCAGCGCAUGGACAGUUATT and anti-sense sequence UAACUGUCCAUGCGCUGGUTC.

What can be put out of sequence — the Shakespeare sequence versus the Prokofiev sequence versus the my-show-business-sense sequence?

gAnti-sense sequence strand only.

All fragments were numbered in the antigenome-sense sequence relative to ANDV.

The anti-sense sequence of the accessible region was introduced into the anti-sense domain of the design framework.

Bacteria are known to have poor control over transcription termination, and transcription of anti-sense sequence has been identified in Mycoplasma genitalium [ 42].