Sentence examples for self region from inspiring English sources

In real-valued negative selection algorithm, the variability of self sample would result in the holes on the boundary between the self and non-self region and the deceiving anomalies hidden in the self region.

The boundary detectors constructed by an aggressive interpretation are allowed to cover a part of self region.

This makes them enable to eliminate the holes on the boundary and have an opportunity to detect the deceiving anomalies hidden in the self region.

Also, they oscillate between feelings of grandiosity and worthlessness, and the sexual attention helps keep them in the self-aggrandizing region of self-esteem".

In addition, ataxin-1 has a self associating region spanning the amino acids 570 to 605 of the wild-type protein.

The present study was conducted to identify the hTLR10 self dimerization region as well as its partners and possible ligands to activate these complexes.

Moreover, the same DNA fragment with its self-promoter region was amplified by using primers 3 and 4 (F Self pil M3 GCTCGGATCCTATCTCTAATAGACTG TTCAAGATATG and R Self pil M3 GCTCGGATCCGACTATCTTGCTAAATACCGAG) and inserted in the same vector, originating "pAM self-pilusM3)".

REP r – regional equipment profile of the r self-governing region; t – number of the equipment types; e – the equipment type; r – the self-governing region; n e; r – number of the e equipment type in the r self-governing region; c – number of the self-governing regions.

EP e; r – equipment profile of the e equipment type in the r self-governing region; e – the equipment type; r – the self-governing region; n e; r – number of the e equipment type in the r self-governing region; c – number of the self-governing regions.

The equipment profile is calculated as follows [24]: {EP}_{e;r}=frac{n_{e;r}}{sum limits_{r=1}^c{n}_{e;r}}, (1 where the variables are as follows: EP e; r – equipment profile of the e equipment type in the r self-governing region; e – the equipment type; r – the self-governing region; n e; r – number of the e equipment type in the r self-governing region; c – number of the self-governing regions.

By tilting the substrate during OAD, the initial growth fluctuation (nuclei) forms a self-shadowed region against highly directional vapor flux, creating a self-organized nanoporous thin film.