Sentence examples for select version from inspiring English sources
Go to http://instantrails.rubyforge.org/ and follow the instructions (make sure you select version 2.0).
Primers were selected through Primer Select (version 4.00 1993–1999, DNA Star Inc., Madison, USA) resulting in the forward primer sequence 5'GCCCGGGATGCAGGAGGAGA and the reverse primer sequence 5'GAGCAGCAGAGATGGAAGGAAAAC.
Select "Ubuntu" from the "Select Distribution", and the latest Live version for the "Select Version" menu.
Connecting Versions 2, 3, and 4/4.5 to the Keitai/Akai series Tamagotchi's~ On the Version 2, select "Version 1".
(Check the sources} Connecting a Version 2 to a Version 3 or 4/4.5~ On the connecting options for the V2, select "Version 1" On the connecting options for the V3 or V4, select "Other".
"Sippin' On", under its original title "Tell Me What You're Sippin' On" was initially to be included on select versions of the "In the Zone" DVD but was omitted.
Result: You are asked to confirm that you want to revert the page to the selected version.
The variety called Green was a selected version of the common weed, although more upright in habit and less inclined to sprawl.
You can see who has made which changes at what time by opening the document, clicking File and then selecting Version history.
This approach does not make periodic copies of the file but, for example, Microsoft Word 2002 used to do this for you if you went to File and selected Version.
