According to the high-throughput resequencing data, N91 and N93 carried a substituted segment covering qSF8-1, whereas N116 and N119 carried a substituted segment spanning qSF10-1.
The segment spans at least 30% of the total extrapolated NRM (f N ≥ 0.30; definition of the extrapolation is the same as in Coe et al. (1978)).
The first model suggested by two groups proposes that amino acids 1 500 form a 12 transmembrane segment spanning region in which amino acids 1 127 form two transmembrane segments, and amino acids 315 411 form a single transmembrane segment with membrane associated segments.
First, the 5' half is highly enriched in G+C nucleotides (Figure 1b), with >85% G+C content in the 150 nt segment spanning codons 7 to 57.
The spinal cord segment spanning between T8 and T12 was taken, post-fixed in 4% paraformaldehyde, cryoprotected in sucrose, embedded in OCT compound and frozen.
CfERVs of intermediate age also showed an antisense integration pattern except for a large segment spanning 30 kb (between 42.5 kb and 72.5 kb) (Fig. 2F).
The P{ry[+t7.2] = ftz/lacC}1 reporter gene transposon contains a 6.5 kb segment spanning the ftz upstream, neural and zebra elements and basal promoter sequences extending through the entire 120 bp 5'-untranslated region [38].
The genomic segment spanning exon 71 to exon 73 of human DMD was amplified by PCR using NEB Phusion polymerase and 200 ng male genomic DNA as template (Promega), generating a 5.6 kb product with NcoI restriction sites at both ends (forward: 5'TTGCandATGGTTACTCTGATCAACTTCTG3' and reverse: 5'GGATACCATGGTGCTCTCATTAGGAGAGATG3').
Genotypes of various SNP and of a 12-bp sequence at rs34104385 were determined by sequencing of a PCR-amplified 4,469 bp segment spanning from 2,185 bp upstream to 2,039 bp downstream of Exon 9 of GABRB2 (Figure S7), as described [11].
Two constructs with the promoter segment spanning from −643 to −1 bp with and without the mutation (referred to as 643-Mutant and 643-Wild type) were prepared by amplification of DNA from one carrier and one non-carrier of the -151C>T mutation.
