Your English writing platform
Free sign upExact(2)
Several mismatches were observed in the segment of the matrix gene targeted by the primers and probe designed for the molecular detection of APMV-1, which were responsible for the false negative results in the diagnostic test conducted.
The COB fragment lost in tunicates is the C-terminal segment of the matrix domain, thus the tunicate protein terminates with the hydrophobic transmembrane H helix.
Similar(58)
We further show that segments of the matrix metalloproteinase (MMP) gene cluster are SASP components in both species, and that CXCL-1 (KC/GRO-α) is a conserved SASP factor that promotes premalignant epithelial cell growth.
The expected amplicon was a 162 bp segment of the influenza B matrix gene.
Oligonucleotide primers for BPIV3 detection and identification (Mfwd: 5´AGTGATCTAGATGATGATCCA 3´ nt - 3960 and Mrev: 5´GTTATTGATCCAATTGCTGT −3´ nt - 4288) were designed based on a 328 bp segment of the consensus BPIV3 Matrix (M) gene.
Reverse transcription-polymerase chain reaction was used to detect segments of the M (matrix), N (nucleoprotein), and F (fusion) genes of human metapneumovirus in bronchoalveolar fluid from 30 infants with severe respiratory syncytial virus bronchiolitis.
The variation of storage moduli of the composites with the processing pressure indicate that almost all of the resin phase had changed into the interfacial phase; the tan δ curves also testified that the ethylene butylene (EB) segment of SEBS matrix was entangled with the molecular chains of polyethylene (PE) fibers.
The smaller ORF1 of segment 8 encodes the matrix protein, while the larger ORF2 encodes an RNA-binding structural protein also with interferon antagonistic properties [ 4, 9- 11].
Further, the correlation between clutter and number of homogenous segments is 0.58; the matrix of pairwise scatter plots in Figure S2 provides a full account.
For detection of AIV, 100 µL from 5 samples was pooled; RNA extracted from pools collected up to July 2012 was subjected to reverse transcription PCR (RT-PCR) to amplify 244 bp of the matrix segment of AIV, according to World Health Organization (WHO) protocol (12 ).
This assay, amplifying a conserved segment of influenza matrix gene to detect influenza A regardless of serotype, also did not detect the presence of this virus in any of the analyzed samples (data not shown).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com