Sentence examples for see the sequence from inspiring English sources

He has, as he wished, lived to see the sequence completed.

By missing it, though, they are denying themselves the chance to see the sequence of rooms used to best advantage.

In theory, writing a logframe should make it easier to plan and manage a project as you can see the sequence in which the actions lead to your overall goal.

It is also common for sequential lineup identification tasks to allow both experimental and actual witnesses to see the sequence of photographs more than once (e.g., Horry, Brewer, Weber, & Palmer, 2015; Wells, 2014), and changing that aspect of the simulation changes the resulting theoretical ROC.

CLICK HERE to see the sequence of numbers.

The T7 template sequence (5' TAATACGACTCACTATAGGCGAAAGCAGGTACTGATTGCGACAATGC 3') contains the T7 promoter region which is the first 18 nucleotides and the remaining 29 nucleotides (see the sequence underlined) are the same sequence as that of the flu template.

When we regularize it, we see the sequences generated by (3.6), which use RGPA.

DNA oligos (see the sequences above) were purchased from IDT, suspended in PBS to a final concentration of 100 μM, and stored at −20 °C.

He had seen the sequence of events unfold in his mind over and over again.

That's not how Turkey saw the sequence of events.

When Ms. Ewing saw the sequence, she said it would be the perfect way to open the film.