The first round of reactions used two of these sets to detect Salmonella O 4, O 9, O 7, O 8, and O 3,10 serogroups.
The lowest correlations are seen in ESR1 – which may be explained by the fact that the first round of reactions failed for this amplicon, so the estimate is based on only one replicate.
PCR products from the first round were used as templates for the second round of PCR reactions, together with gene-specific reverse primers and a universal forward primer containing a 5'-amino modification (5'-GCTGAACAGCTATGACCATG-3'; Oswel).
A second round of deprotection reactions (on-resin deprotection step(s) 2, Scheme 2) then facilitated the removal of the remaining Tyr side-chain protecting groups at positions 10 and/or 14.
It does seem quite possible that a second round of optimization of reaction and thermocycle conditions could produce bands for the missing regions.
His economic team's resistance to a second round of stimulus, "lukewarm" reaction to Congressional jobs legislation, and prioritization of deficit reduction over job creation certainly has the feel of a taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet taking-in-the-damage-from-2,500-feet
The 2 products were used as a template for a second round of polymerase chain reaction (PCR) with primers (GCGCGGTACCGCATGGTGAGCAAGGGCGAG and GCGCGGATCCTCAACAGCCGCATAACCC).
A second round of polymerase chain reaction (PCR) using M13-tagged primers (TGTAAAACGACGGCCAGT CATGGCCGGCGAAGGAGATCA and CAGGAAACAGCTATGAC GTTTACAAGCAAAGTATTACTTTGTCT) and Herculase II Fusion DNA polymerase (Agilent, Santa Clara, CA, USA) in a 35-cycle reaction amplified CRBN splice variants.
The three forward primers for the RPS10 coding regions introduced an overlap with the RPS10B promoter amplicon, which was then fused upstream of each cDNA by overlap extension in a second round of polymerase chain reaction.
The second round of PCR (25 μl reactions) was performed using BioMix (Bioline, London, UK) and 2 μl of first-round PCR product.
