Sentence examples for second highest fraction of from inspiring English sources

A potential centromere monomer, TGGAAACCCCAAATTTTGGGCGCCGGG (27 bp), is moderately high in frequency across the scaffolds and represents the second highest fraction of the genome covered, with 5183 loci covering ∼1.8 Mbp (∼0.009% of the genome).

In Figure 2 we show the FDR networks of 1984 and 2009 (the first is the one with the highest fraction of elements in the LCC whereas the second is the one with the lowest fraction).

The first component is constructed so that it accounts for the highest fraction of the total variance in the data; the second component is constructed to be orthogonal (uncorrelated) to the first component and account for the highest fraction of the variance in this direction.

The first (TCGA) has a similar distribution of ER-status, HER2-status and PAM50 subtypes as the Oslo2 data set, while the second (DBCG) has a higher fraction of ER-negative and HER2-positive tumors of the basal-like and HER2-enriched subtypes according to the mRNA expression-based PAM50 classification (Additional file 10).

Very high fraction of first and second order streams point out the structural deformation, mainly as fractures, lineaments, and deformed litho units.

A higher fraction of third chromosome genes are differentially expressed between Y M and III M house fly males than genes on any other autosome (fig. 2 A).

The Public Policy Polling survey did not provide a third-party option, but an unusually high fraction of their Republican respondents — 19 percent — said they were undecided in the race.

First, it is long known that high fraction of oxygen in inspired air (FiO2) may be toxic for the lungs.

This can cause a relatively high fraction of deletions to be lethal in the first interval.

First of all, this may be related to the peculiarities of their phase composition, high fraction of open porosity, and high permeability.

First of all, this fact is related to the peculiarities of their phase composition, high fraction of open porosity, and high permeability.