Sentence examples for second highest fraction from inspiring English sources

Exact(1)

A potential centromere monomer, TGGAAACCCCAAATTTTGGGCGCCGGG (27 bp), is moderately high in frequency across the scaffolds and represents the second highest fraction of the genome covered, with 5183 loci covering ∼1.8 Mbp (∼0.009% of the genome).

Similar(59)

ICD-10 codes for (unspecified) viral infections (B34.9, B97.8, and J06.9) had the second highest attributable fractions estimated at 16% for seasonal and 24% or pandemic influenza.

Oregon, for instance, which had among the highest per capita rate of protesters on Saturday, has the fourth-highest fraction of self-identified liberals.

The major North Africa/Arabian Gulf divide still represented the major subpopulation fractions; however, the Arabian Gulf showed a second minor population, with the highest fraction individuals being from Iraq.

In Figure 2 we show the FDR networks of 1984 and 2009 (the first is the one with the highest fraction of elements in the LCC whereas the second is the one with the lowest fraction).

The hexane fraction presented the second highest total phenolic compound values.

The apoptosis analysis could be divided into two phases: first, higher cell fraction was observed in early apoptosis quadrant (∼75%) after treatment with PLPT, whereas only approximately 40% of cells were observed in early apoptosis quadrant after free LPT treatment at 24 h.

The involvement of mangiferin in the enzyme inhibition was also supported by the fact that the sub-fraction with the second highest content of mangiferin exerted the second highest inhibitory activity.

To date, there are no known functions for miR-484 which is the second highest expressed miRNA in the plasma microvesicles fraction based on normalized expression (Table 1).

The first component is constructed so that it accounts for the highest fraction of the total variance in the data; the second component is constructed to be orthogonal (uncorrelated) to the first component and account for the highest fraction of the variance in this direction.

Gallup finds that nearly seven out of ten Americans think wealth should be more evenly distributed, the highest fraction since the question was first asked in 1984.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: