Sentence examples for screening of the insertion from inspiring English sources

Screening of the insertion sequence against a reference collection of repeats (Repbase) using CENSOR software [28] identified putative fragments of An. gambiae TEs, including Harbinger1_AG DNA transposon in the IRs and SINEX-1_AG and GYPSY9-LTR_AG retrotransposons in the spacer (Supplementary Table S1).

Clones of transformed, neomycin resistant ES cells were screened for the insertion of the correct modification in the hmmr gene locus.

The colonies obtained after transformation that showed resistance to paromomycin were screened for the insertion of CzPSY cDNA in their genome by PCR test.

Bacterial colonies were screened for the insertion of plasmid DNA via PCR using the pJET1.2/blunt primers pJet_T7_for: TAATACGACTCACTATAGGG and pJet_rev: GAAGAACATCGATTTTCCATGGCAGC.

We previously reported screening of the Tos17 retrotransposon-insertion mutant collection for rice cultivar 'Nipponbare' (Miyao et al. [2003]; https://tos.nias.affrc.go.jp/) by iodine staining to detect starch accumulation in leaves of seedlings (stain-positive plants); as a result, five candidate lines were selected from more than 6300 lines of the M2 generation (Hirose et al. [2013]).

To delete CAC1493-1494 and the intron, secondary screening by successive transfer of the insertion mutant DC1494 into RCM medium was conducted in the absence of erythromycin.

You could argue that this was just the way EL James wrote it; equally, it is a rare book that makes it on to a screen without the insertion of Hollywood's obligatory codes, where men say things and women smile at them.

Thus, expression of EGFP is a suitable choice for screening of the BAC recombinant containing insertions, especially when the percentage of allele replaced BACs is relatively low.

Fluorescence screening of gene insertion on bacterial culture plates can be performed using the pCfvtx plasmid from Truong's cassette methodology because the successful insertion creates a C-terminal fusion of the gene with Venus (yellow fluorescent protein mutant)[6].

Further crossing of G0 flies, screening of the transformants and balancing of insertions performed at the Transgenic Fly Facility at C-CAMP facility at NCBS campus, Bangalore, India.

The application of absorbing areas on rigid screens significantly increases the insertion loss by between 3 and 6 dB.