Your English writing platform
Discover LudwigExact(60)
But thrift alone does not seem to be enough to explain what is now a medium-term trend, since Fairtrade, another ethical certification with a price premium, has not suffered the same reverse, with sales rising by an estimated 12% last year.
Two different nanoparticle oxide systems are obtained depended on Co Ce atomic ratio (R) using the same reverse nanoemulsion method.
By reversing the bias, all diode behaviors are switched too, so if we consider that D3 and D4 have the same reverse behavior (leaky), the differences observed in Figure7b,c result only from D2. Higher blocking voltages are reached under forward bias as D2 is off.
Comparing the two study primary cloud forests to the primary cloud forest at Monteverde, Costa Rica, also sampled for all trees at least 10 cm dsh, there was a similar number of stems (555/ha) but more basal area (62 m2/ha: Nadkarni et al. 1995) but the same reverse J size distribution.
For expressing with the 12 designed RBS sequence (R1 R12) and AS of 7 nt as well as with RBS of R4 and AS of 6 nt (R4a) or 8 nt (R4b), gadB2 was amplified similarly using the 14 different forward primer Rn-B2-F and the same reverse primer gadB2-R, digested with AflII and BamHI, and ligated into pJYW-5 digested with the same enzymes, resulting in the 14 plasmids of pJYW-5-Rn-gadB2.
In a way, Mount Kimbie became more like a traditional band echoing the same reverse course towards "becoming more human" that Daft Punk, who famously eschewed computer programs in favor of live musicianship on Random Access Memories, is also taking.
Nevertheless, unaltered 1797 dies were used even after the 1798/7 pieces; this can be shown because the same reverse die was used for both issues, and on the 1797-dated pieces, the reverse die displays greater wear.
Using the same Reverse Consumerism Model, this time we've constructed platforms that allow us to push multiple artists, with six levels for advertisers to utilise - Premium A (Madonna, Jay-Z, Beyonce etc) down through B, C, D, E and F. The first week of sales and executives are negotiating with top tier advertisers for Jay-Z's album.
A second, semi-nested PCR was performed using the forward primer 5'- GAGGGTTTAGTTTTTATTATTGTTAAGAAT -3' (same reverse).
The same reverse primer was used for both amplifications: 5'-ATATAAGCTTCTAATGCTCATCAAAACCAG-3'.
This consistently detected multiple species from the same reverse transcription reactions (Fig. 3F).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com