Sentence examples for rp amplified from inspiring English sources
TGGAAGTCCCTTTAGGGTTTCGGA (FP) and TGGTTCCTCCATCGACCAGATCAA (RP) amplified a 236-bp Bcl2l1 promoter region; TGTTGGACACCGACATCGAAAGGA (FP) and AGAAAGGGACTGGCATCGAGACAT (RP) amplified a 177-bp Bcl2l1 first-intron region; and TGAGTCCTATCCTGGGAACCATCA (FP) and ATTTATAGGAACCCGGATGGTGGG (RP) amplified a 284-bp Gapdh promoter region.
The PCR amplification of 1 363 nucleotides was done using Taq DNA polymerase (MBI Fermentas) with the following forward and reverse oligonucleotide primers: FP: 5' CATGCCATGGATCATTTAAAGCATTTGC 3' and RP: 5' CCGCTCGAGGGCTTGCTCTCTAATGG 3' The amplified DNA was inserted into NcoI/XhoI digested expression plasmid vector pET 28a (Novagen, Madison, WI, USA) with C-terminal six residue His tag.
The PCR amplification of 1 144 amino acids was done using Taq DNA polymerase (MBI Fermentas) with the forward and reverse oligonucleotide primers, FP: 5' CATGCCATGGATCATTTAAAGCATTTGC 3' and RP: 5' CCGCTCGAGGCCATTCAATAACGCATAG 3' The amplified DNA was inserted into NcoI/XhoI digested expression plasmid vector pET 28a (Novagen, Madison, WI, USA) with C-terminal six residue His tag.
Following oligonucleotide primers were used as forward and reverse primers: FP: 5' CTAGCTAGCGAGCGAGTCTCTTTTCAGCCTTT 3' and RP: 5'CGGCTCGAGTATGGCGACTAATTCTCCTTGTTTT 3' The amplified PCR product was digested with Nhe1/Xho1 and inserted into Nhe1/Xho1 digested expression plasmid vector pET21c (Novagen, Madison, WI, USA).
Thus we used the RP-SISPA procedure [14] to construct a library of amplified DNA fragments from each total viral RNA sample.
Bisulfite-treated DNA was PCR amplified with strand-specific primers (for bisulfite-converted top strand of Zp and Rp) for BGS.
